Phân tích một tập tin với D

Question

Tôi mới trong D và muốn phân tích một tập tin sinh học của mẫu

>name1 
acgcgcagagatatagctagatcg 
aagctctgctcgcgct 
>name2 
acgggggcttgctagctcgatagatcga 
agctctctttctccttcttcttctagagaga 
>name2 
gag ggagag 

như vậy mà tôi có thể nắm bắt được name1 'tiêu đề', name2, name3 với 'chuỗi tương ứng 'dữ liệu, công cụ ..acgcg ....

Bây giờ tôi có this.but nó sẽ dòng chỉ lặp theo dòng,

import std.stdio; 
import std.stream; 
import std.regex; 


int main(string[] args){ 
    auto filename = args[1]; 
    auto entry_name = regex(r"^>(.*)"); //captures header only 
    auto fasta_regex = regex(r"(\>.+\n)([^\>]+\n)"); //captures header and correponding sequence 

    try { 
    Stream file = new BufferedFile(filename); 
    foreach(ulong n, char[] line; file) { 
     auto name_capture = match(line,entry_name); 
     writeln(name_capture.captures[1]); 
    } 

    file.close(); 
    } 
    catch (FileException xy){ 
    writefln("Error reading the file: "); 
    } 

    catch (Exception xx){ 
    writefln("Exception occured: " ~ xx.toString()); 
    } 
    return 0; 
} 

Tôi muốn biết một cách tốt đẹp của giải nén header và dữ liệu chuỗi như vậy mà tôi có thể tạo ra một mảng kết hợp nơi mỗi mục tương ứng với một mục trong tệp

[name1:acgcgcagagatatagctagatcgaagctctgctcgcgct,name2:acgggggcttgctagctcgatagatcgaagctctctttctccttcttcttctagagaga,.....] 

Answer 1

tiêu đề nằm trên dòng riêng của nó phải không? vậy tại sao không kiểm tra nó và sử dụng một appender phân bổ cho giá trị

auto current = std.array.appender!(char[]); 
string name; 
foreach(ulong n, char[] line; file) { 
     auto entry = match(line,entry_name); 
     if(entry){//we are in a header line 

      if(name){//write what was caught 
       map[name]=current.data.dup;//dup because .current.data is reused 
      } 
      name = entry.hit.idup; 
      current.clear(); 
     }else{ 
      current.put(line); 
     } 
} 
map[name]=current.data.dup;//remember last capture 

bản đồ là nơi bạn sẽ lưu trữ các giá trị (một string[string] sẽ làm)

Answer 2

Đây là giải pháp của tôi mà không biểu thức thông thường (I đừng tin vào đầu vào đơn giản như vậy, chúng ta cần regexp):

import std.stdio; 
import std.stream; 

int main(string[] args) { 
    int ret = 0; 
    string fileName = args[1]; 
    string header; 
    char[] sequence; 
    string[string] content; 
    try { 
    auto file = new BufferedFile(fileName); 
    foreach(ulong lineNumber, char[] line; file) { 
     if (line[0] == '>') {  
     if (header.length > 0) { 
      content[header] = sequence.idup; 
      sequence.length = 0; 
     } // if 
     // we have a new header, and new sequence will start after it 
     header = line[1..$].idup; 
     content[header] = ""; 
     } else { 
      sequence ~= line; 
     } // else 
    } // foreach 
    content[header] = sequence.idup; 
    file.close(); 
    } 
    catch (OpenException oe){ 
    writefln("Error opening file: " ~ oe.toString()); 
    } 
    catch (Exception e){ 
    writefln("Exception: " ~ e.toString()); 
    } 
    writeln(content); 
    return ret; 
} // main() function 

/+ -------------------------- BEGIN OUTPUT ------------------------------- + 
["name3":"gag ggagag", "name1":"acgcgcagagatatagctagatcgaagctctgctcgcgct", "name2":"acgggggcttgctagctcgatagatcgaagctctctttctccttcttcttctagagaga"] 
+ -------------------------- END OUTPUT --------------------------------- +/